Cted mutations and have no contamination. To produce infectiousThirty thousand PMCted mutations and have no

Cted mutations and have no contamination. To produce infectiousThirty thousand PM
Cted mutations and have no contamination. To produce infectiousThirty thousand PM1 cells were infected with 18 ng of p24 for each virus. Briefly, cells were incubated with viruses for 1 h at 37 . After incubation, cells were washed to remove unbound viruses and seeded in 96-well plates. Cell-free medium containing viruses was withdrawn for p24 measurements at days 3 and 7 p.i. The same volumes of fresh medium and new cells were added at each time point. Experiments were done in triplicate and each study of RT mutated viruses was performed separately.Determination of integratedHIV DNAA total of 2 ? 105 PM1 cells were infected with 125 ng p24. Cellular DNA was extracted at 48 h.p.i., using a DNeasy blood and tissue kit (Qiagene). A two-step Alugag PCR was performed as previously described [34]. The first-round PCR was performed with a 65 ng DNA sample in a 25 reaction with primers Alu-F: 5-GCCTC CCAAAGTGCTGGGATTACAG-3 and Gag-R: 5-GTTCCTGCTATGTCACTTCC-3. The first cycle conditions were: 95 for 2 min, followed by 40 cycles of 95 for 15 s, 50 for 15 s, 72 for 3 min 30 s, and final elongation was at 72 for 5 min. The secondnested PCR was performed on a Corbett Rotor-GenePham et al. Retrovirology (2016) 13:Page 9 of6000 thermocycler, using Platinum quantitative PCR (qPCR) SuperMix-UDG (Invitrogen) with 5 of firstround PCR product in a 20 reaction. The primer sequences were LTR-F: TTAAGCCTCAATAAAGCTTG CC and LTR-R: GTTCGGGCGCCACTGCTAGA with the following cycle conditions: 50 for 2 min, 95 for 2 min, 60 cycles of 95 for 10 s, 60 for 10 s and PubMed ID:https://www.ncbi.nlm.nih.gov/pubmed/28242652 72 for 45 s. All samples were normalized in terms of -globin content. The levels of DM-3189 msds integration are relative to WT virus at 0 h post infection.Statistical analyses4.5.6.Each experiment was repeated twice using three replicate samples each time. Data analyses including linear and non-linear regressions, and determinations of EC50, standard deviation, 95 confidence intervals, and relative FC were calculated using GraphPad Prism 5.0 software. We used two-tailed Student’s t test with a 0.05 cut-off point to compare the best-fit values or means of each pair of different data sets.Authors’ contributions HTP performed experiments and wrote the first version of the manuscript including figures. HTP and TM contributed to study designs, analyzed and interpreted data. MAW supervised the study and provided grant support needed for its implementation. He also contributed to the writing of the manuscript. All authors reviewed and finalized the final version before submission. All authors read and approved the final manuscript. Author details 1 McGill University AIDS Centre, Lady Davis Institute for Medical Research, PubMed ID:https://www.ncbi.nlm.nih.gov/pubmed/27362935 Jewish General Hospital, 3755 Ch. C e-Ste-Catherine, Montreal, QC H3T 1E2, Canada. 2 Division of Experimental Medicine, Faculty of Medicine, McGill University, Montreal, QC, Canada. 3 Department of Microbiology and Immunology, Faculty of Medicine, McGill University, Montreal, QC, Canada. Acknowledgements This work was funded by The Canadian Institutes of Health Research. HTP is the recipient of a Canadian HIV Trials Network Postdoctoral Fellowship. We thank Susan Germinario, Maureen Oliveira, Ilinca Ibanescu for technical assistance and Ying-Shan Han for helpful suggestions. We thank Hongtao Xu and Diane Singhroy for providing some of the plasmids used in this study. We thank Estrella Moyal for help with manuscript preparation. Competing interests The author.