ut their comparative detection ” sensitivities, which is of utmost importance when assessing microbial water quality. Therefore, eighteen published primer sets, specific for amplifying various regions of the EnV genome, were selected in this study in a comparative evaluation of detection sensitivity. The primer sets chosen are specific for all pathogenic but highly diverse human enteroviruses, with the exception of EvVP1F/EvVP1R, which specifically selects for EV71, causative agent of hand, foot, and mouth disease in children. All primer sets were initially tested under standard PCR conditions using single-source cDNA from wastewater influent as the nucleic acid template. Five microliters of cDNA was added to 20 mL PCR mix containing 1X Taq get BCTC Reaction buffer, 2.0 mM MgCl2 solution, 200 nM of each dNTP, 400 nM “9226994 of forward and reverse primers, and 2 units of Taq DNA polymerase. Reaction tubes were placed in a MastercyclerH Gradient for an initial denaturation at 94uC for 5 min., followed by 40 cycles of denaturation at 94uC for 30 sec., annealing at 56uC for 20 sec., and extension at 72uC for 30 sec., completed by a final extension at 72uC for 5 min. EnV detection was analyzed by gel electrophoresis. 10 mL PCR product+2 mL 6x loading dye was loaded into the wells of an ethidium-bromide stained 2% agarose gel in 0.5x TBE buffer, to which 120V was applied until sufficient fragment migration had 2 May 2012 | Volume 7 | Issue 5 | e32442 Environmental Water Sample Collection Between June 2010 and October 2011, twenty-two surface water samples were collected from various marine and freshwater sites around the island of Oahu. No specific permits were required for sample collection. Marine sites include Sand Island State Recreational Area, Kailua Bay, Waikiki Beach, Pokai Bay, Maunalua Bay, Kualoa Regional Park, West Loch Community Shoreline Park, Kahala Beach, and the beach parks of Ala Moana, Diamond Head, Maili, Waialae, Kaiaka Bay, Kahana Bay, Ko Olina, Bellows Field, and Punalu’u. Freshwater sites include Wahiawa Reservoir, Manoa Stream, and Kaelepulu Stream. The sample collected from Ala Wai Canal was brackish. All sampling locations receive, to varying Detection of Enterovirus from Environmental Water occurred. A 50-bp DNA ladder was used for 
indication of PCR product fragment size. The Molecular Imager Gel Doc XR+system was used to visualize results under UV light. PCR conditions for all primer sets that successfully detected EnV from untreated wastewater were then adjusted for optimal sensitivity in preparation for environmental detection. Optimiza- tion brackets included annealing temperature, MgCl2 concentration, primer concentration, and the presence or absence of 0.1 mg/mL molecular biology grade, protease/nuclease-free, fraction V BSA . Using the final optimized conditions, primer set detection limits were determined by PCR using 10-fold serial dilutions of influent sewage cDNA template. Detection limits were denoted by the highest dilution yielding Primer EV1/EV2 EntAF/R EntBF/R EntCF/R EQ-1/EQ-2 EvVP1F/R 2AB/2C3A EV.1/EV.2 Lees3/4 P1/P3 P2/P3 EV-L/-R Abba1/2 EVZ1/Z2 EVF/EVR ev1q/ev2q Ent1/Ent2 EvUp/Dwn Sequence CGGCCCCTGAATGCGGC/CACCGGATGGCCAATCCA TNCARGCWGCNGARACNGG/ANGGRTTNGTNGMWGTYTGCCA GCNGYNGARACNGGNCACAC/CTNGGRTTNGTNGANGWYTGCC TNACNGCNGTNGANACHGG/TGCCANGTRTANTCRTCCC ACATGGTGTGAAGAGTCTATTGAGCT/CCAAAGTAGTCGGTTCCGC GAGAGTTCTATAGGGGACAGT/AGCTGTGCTATGTGAATTAGGAA GAIGYIATGGARCARGG/GGICCYTGRAAIARIGCYTC GGCCCCTGAATGCGGCTAAT/CAATTGTCACCAT
Heme Oxygenase heme-oxygenase.com
Just another WordPress site
