, 9492013 The Authors. Published by John Wiley and Sons, Ltd on behalf

, 9492013 The Authors. Published by John Wiley and Sons, Ltd on behalf of EMBO.Research ArticleMicroRNA146 represses endothelial activationwww.embomolmed.orgANF-B promoter-reportercontrol mimic miR-146a mimic handle inhibitor miR-146 inhibitorRelative Luciferae ActivityB1.15’2.30’1.0.15’1.30’0.IL-densitometrypERK ERKcontrol mimic miR-146a mimicRelative Luciferae Activity*****1.15’1.30’1.1.15’3.30’1.IL-densitometrypERK ERKNS IL-control inhibitor miR-146 inhibitorNSIL-CRelative mRNA ExpressionDEGR-1 EGR-1h IL-*EGR-1 EGR-** **miR-146a miR-146 mimic inhibitorE3′-UUGGGUACCUUAAGUCAAGAGU-5’miR-146aF1h IL-c-Fos c-Jun5′–TGTTTTAATAAAACTGTTCTCAG–3′ EGR-Wild-type 3′ UTR Mutant 3′ UTR** **EGR-Figure 5.TRAFmiR-146a miR-146 mimic inhibitor2013 The Authors. Published by John Wiley and Sons, Ltd on behalf of EMBO.EMBO Mol Med (2013) five, 949www.embomolmed.orgResearch ArticleHenry S. Cheng et al.MiR146 targets the RNAbinding protein HuR to control endothelial activation HuR was previously identified to promote endothelial activation in response to LPS therapy of endothelial cells by facilitating NF kB activation (Rhee et al, 2010). Interestingly, microRNA target prediction programs (Targetscan and Pictar) suggested that HuR may well be a direct target of miR146 (Fig 7A, Fig. S4). We confirmed that luciferase constructs containing the HuR 30 UTR could be repressed by miR146a (Fig 7B), as well as located that levels of HuR mRNA (Supporting Info Fig S5) and protein (Fig 7C) have been suppressed or elevated when miR146 was overexpressed or knockeddown in endothelial cells, respectively. To test the functional importance of HuR in IL1bmediated endothelial activation, we knocked down HuR and measured the adhesion of THP1 cells to endothelial cells. HuR knockdown inhibited THP1 adhesion to IL1b treated endothelial cells (Fig 7D). Moreover, HuR knockdown also inhibited THP1 adhesion to TNFa treated cells (Supporting Information Fig S6), suggesting that HuR broadly facilitates endothelial activation. To assess the contribution of HuR to the enhanced adhesiveness of miR146 inhibitortreated endothelial cells, we knockeddown HuR, and have been capable to block the increase in THP1 adhesion (Fig 7E). Interestingly, VCAM1, ICAM1, SELE and MCP1 contain AUrich components (AREs) in their 30 UTRs (Supporting Details Fig S7). AREs can confer instability to transcripts, which can be antagonized by HuR binding to these web sites (Fan Steitz, 1998). We consequently tested no matter whether HuR could regulate the expression of those inflammatory genes.Tamibarotene Though VCAM1 and MCP1 were highly enriched in HuR immunoprecipitates from IL1btreated cells (Supporting Facts Fig S8A), HuR knockdown failed to have an effect on the induction of VCAM1 or MCP1 at the mRNA or protein level (Fig 7F, Supporting Facts Figs S8B, C, and S9B), suggesting that they are not functional targets of HuR.Etoposide phosphate Additionally, we found that NFkB activity was not altered by HuR knockdown (Supporting Information Fig S8D), neither was the induction of EGR3 (Supporting Info Fig S9B).PMID:24293312 This was in contrast to knockdown of one more miR146 target, TRAF6, which decreased NFkB activity (Supporting Data Fig S8D), the induction of adhesion molecules and EGR transcription variables (Fig 7F, Supporting Information Fig S9B). In contrast towards the lack of regulation of VCAM1/MCP1 by HuR, eNOS mRNAand protein levels were elevated in HuR knockdown cells and eNOS was not downregulated in response to IL1b treatment of those cells (Fig 7F and G). Knockdown.